View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10202_low_15 (Length: 220)
Name: NF10202_low_15
Description: NF10202
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10202_low_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 29 - 211
Target Start/End: Original strand, 39097571 - 39097754
Alignment:
| Q |
29 |
aagaataagaagagttccgtttcaccttcaattgcagcttgcttctacgggtaactctctcttttcttcccttacaaatccaactaaacattataatgta |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| ||||| |
|
|
| T |
39097571 |
aagaataagaagagttccgtttcaccttcaattgcagcttgcttctacgggtaactctctctttacttcccttacaaatgcaactaaacattatcatgta |
39097670 |
T |
 |
| Q |
129 |
-nnnnnnnnnatttaaaatttattgattcaagttcctttactgcgtgctatttaggttttcacttttccttgttttgtcctatg |
211 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39097671 |
tttttttttttttttaaatttattgattcaagttcctttactgcgtgctatttaggttttcacttttccttgttttgtcttatg |
39097754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University