View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10202_low_7 (Length: 392)
Name: NF10202_low_7
Description: NF10202
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10202_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 17 - 320
Target Start/End: Original strand, 45462483 - 45462786
Alignment:
| Q |
17 |
attgaaactgatgtttgatggtgtatgttttgagattatgtatggttcctgttttattttgcaattataatcagcaagggtttgattgttccgtggattg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45462483 |
attgaaactgatgtttgatggtgtatgttttgagattatgtatggttcctgttttattttgcaattataatcagcaagggtttgattgttccgtggattg |
45462582 |
T |
 |
| Q |
117 |
cggtggggatggtggtaaggcattgagaatgtgagattgtgttggaatcgaaaactaacttcgtgatatccttatggattattttggaaatttggtgttt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45462583 |
cggtggggatggtggtaaggcattgagaatgtgagattgtgttggaatcgaaaactaacttcgtgatatccttatggattattttggaaatttggtgttt |
45462682 |
T |
 |
| Q |
217 |
gaatgtgtgcattgaatttgtatttacttgattatttaagcaaaacattgagaattaatgaattggaataagcaccgtacataatgctgttagctgttaa |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45462683 |
gaatgtgtgcattgaatttgtatttacttgattatttaagcaaaacattgagaattaatgaattggaataagcaccgtacataatgctgttagctgttaa |
45462782 |
T |
 |
| Q |
317 |
ccat |
320 |
Q |
| |
|
|||| |
|
|
| T |
45462783 |
ccat |
45462786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University