View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10204_17 (Length: 318)
Name: NF10204_17
Description: NF10204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10204_17 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 30 - 318
Target Start/End: Complemental strand, 39281000 - 39280712
Alignment:
| Q |
30 |
aaaggagtttcttatcttaccaatagtgatctgttaagagaaactgattctttgttggccttgatggaaggaattgggaaaaaacctaatactccaatga |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39281000 |
aaaggagtttcttatcttaccaatagtgatctgttaagagaaactgattctttgttggccttgatggaaggaattgggaaaaaacctaatactccaatga |
39280901 |
T |
 |
| Q |
130 |
gcgaacagaacaaggtggttgttgagataatggatttggtggaagatgatggggttatggtgatgaatgaagttttggttagaattaaagaatttgggga |
229 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
39280900 |
gtgaacagaacaaggtggttgttgagataatggatttggtggaagatgatggggttatggtgatgaatgaagttttggttagagttaatgaatttgggga |
39280801 |
T |
 |
| Q |
230 |
gagggagaaactgggctgtcttggttttggagaagtggtggaattggtttgtgttttgaagagattggaaatgtgcagagagagaataa |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39280800 |
gagggagaaactgggctgtcttggttttggagaagtggtggaattggtttgtgttttgaagagattggaaatgtgcagagagagaataa |
39280712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University