View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10204_low_2 (Length: 277)
Name: NF10204_low_2
Description: NF10204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10204_low_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 14 - 268
Target Start/End: Original strand, 38931694 - 38931948
Alignment:
| Q |
14 |
tcaacttcttcttcttcctctactctcttttctccatgctcactatgtgtttttgactcttctgatcttatttctggttccaattccaaaggtggcctta |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38931694 |
tcaacttcttcttcttcctctactctcttttctccatgctctctatgtgtttttgcctcttctgatcttatttctggttccaattccaaaggtggcctta |
38931793 |
T |
|
| Q |
114 |
taatactaagacctcctttaacatgtataatttggtgctttctatgttcttcatctggagattgaagctttctaattatactttctttcactttcaaaac |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38931794 |
taatactaagacctcctttaacatgtataatttggtgctttctatgttgttcatcttgagattgaagctttctaattatactttctttcactttcaaaac |
38931893 |
T |
|
| Q |
214 |
ttgtcccaagaaacgtgaatcaaaaccactgaacatgttgttagtttcttcttct |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38931894 |
ttgtcccaagaaacgtgaatcaaaaccactgaacatgttgttagtttcttcttct |
38931948 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University