View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10204_low_3 (Length: 277)
Name: NF10204_low_3
Description: NF10204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10204_low_3 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 104; Significance: 7e-52; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 104; E-Value: 7e-52
Query Start/End: Original strand, 93 - 272
Target Start/End: Complemental strand, 28850491 - 28850311
Alignment:
| Q |
93 |
aagccggacaaaacaatatatagaagacaaaatgatttggacatagcatagaaggagagaatatttaattggacaaattttttgacattatcattttaac |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| | ||||||||||||||||||| ||| |
|
|
| T |
28850491 |
aagccggacaaaacaatatatagaagacaaaatgatttgcacatagcatagaaggagagaatatttaattgga-attttttttgacattatcatttgaac |
28850393 |
T |
 |
| Q |
193 |
cac--nnnnnnnnnttcatggattcgcctctagaacagtgagggagttaaaaaaggatgatcaatgtttgattcatctcact |
272 |
Q |
| |
|
||| ||||||||| ||| | |||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
28850392 |
cacaaaaaaaaatattcatggatccgcatttagaacagtgagggagttaaaaaaggatgatcaatgtttgattcatgtcact |
28850311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University