View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10205_low_12 (Length: 241)
Name: NF10205_low_12
Description: NF10205
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10205_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 7 - 223
Target Start/End: Complemental strand, 39744540 - 39744324
Alignment:
| Q |
7 |
tactaccggtgtgaaatagttgagtaaattcattgtggttagtttttagtggagggatttggtaattgtttgtaagaatatgcgtgatcaaaatgcatgt |
106 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39744540 |
tactactggtgtgaaatagttgagtaaattcattgtggttagtttttagtggagggatttggtaattgtttgtaagaatatgcgtgatcaaaatgcatgt |
39744441 |
T |
 |
| Q |
107 |
agcacttgtcaagtcgcacttgctagctactatagtgagcatgcattatgatccttttgtatagtgcaaatatataacaaacaaaaacgtaactgatgca |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
39744440 |
agcacttgtcaagtcgcacttgctagctactatagtgagcatgcattatgatccttttgtatagtgcaaatatataacaaacaaaaacgtaactaatgca |
39744341 |
T |
 |
| Q |
207 |
tggtgatggggcccttc |
223 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
39744340 |
tggtgatggggcccttc |
39744324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University