View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10205_low_9 (Length: 268)
Name: NF10205_low_9
Description: NF10205
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10205_low_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 15 - 251
Target Start/End: Complemental strand, 27361068 - 27360832
Alignment:
| Q |
15 |
agtttgatgaggctttggtgaatttaaatgatatggttaggtggggttattctcttgagggaattgcatttgaggaagtgattgaaggactttgtggtca |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27361068 |
agtttgatgaggctttggtgaatttaaatgatatggttaggtggggttattctcttgagggaattgcatttgaggaagtgattgaaggactttgtggtca |
27360969 |
T |
|
| Q |
115 |
gggtagagtggatgaggcagtgtcaactttgcttcttttgcaagcaaatggaggatttcttgatagagtttcttttggtgtattggttaatgagcttaat |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27360968 |
gggtagagtggatgaggcagtgtcaactttgcttcttttgcaagcaaatggaggatttcttgatagagtttcttttggtgtattggttaatgagcttaat |
27360869 |
T |
|
| Q |
215 |
gcacatgggagagtgttttgtgcttcttttttgtttg |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27360868 |
gcacatgggagagtgttttgtgcttcttttttgtttg |
27360832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University