View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10206_high_1 (Length: 306)
Name: NF10206_high_1
Description: NF10206
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10206_high_1 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 173; Significance: 5e-93; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 173; E-Value: 5e-93
Query Start/End: Original strand, 19 - 203
Target Start/End: Original strand, 30158841 - 30159025
Alignment:
| Q |
19 |
ctccagtggtgaaatcggctccttccgatgtaattgacggcaatgtgcgttctaacggaaaatctggaaggaagaaaggtagggtttctgagatgaaatt |
118 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
30158841 |
ctccggtggtgaaatcggctcctttcgatgtaattgacggcaatgtgcgttctaacggaaaatcaggaaggaagaaaggtagggtttctgagatgaaatt |
30158940 |
T |
 |
| Q |
119 |
gtccgaggagaatcgacgaaggtcgccgagattatcaggtgaatctgacggaagaggctcttcttcttgttctgttaaggtgtgt |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30158941 |
gtccgaggagaatcgacgaaggtcgccgagattatcaggtgaatctgacggaagaggctcttcttcttgttctgttaaggtgtgt |
30159025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University