View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10206_low_10 (Length: 227)
Name: NF10206_low_10
Description: NF10206
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10206_low_10 |
 |  |
|
| [»] chr4 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 37926540 - 37926766
Alignment:
| Q |
1 |
ataaattgattttctacattcaaaatgagtttgagtatggattcagactggatacttatatccctgttacttatctcgtacccatgttttaaaatcattg |
100 |
Q |
| |
|
||||||| |||| ||||||||| ||||||||| |||||| ||||||| || |||||||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
37926540 |
ataaattaatttactacattcaggatgagtttgggtatgggttcagaccgggtacttatatccctgttacttgtctggtacccatgttttaaaatcattg |
37926639 |
T |
 |
| Q |
101 |
tttaaaattaaattaaaggatgataaggataattttgcccaataaatttgatatctccaccaagttctttcatgtaggctgttggggcaaaattagactt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37926640 |
tttaaaattaaattaaaggatgataaggataattttgcccaataaatttgatatctccaccaagttctttcatgtaggctgttggggcaaaattagactt |
37926739 |
T |
 |
| Q |
201 |
ttagtaaaggatatttttggccgttta |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
37926740 |
ttagtaaaggatatttttggccgttta |
37926766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 96
Target Start/End: Complemental strand, 21956928 - 21956833
Alignment:
| Q |
1 |
ataaattgattttctacattcaaaatgagtttgagtatggattcagactggatacttatatccctgttacttatctcgtacccatgttttaaaatc |
96 |
Q |
| |
|
||||||||||||||||||||| || ||||||| |||||| ||| | ||| || |||||||| |||||| || ||||||| |||||||||||| |
|
|
| T |
21956928 |
ataaattgattttctacattcgtaacgagtttgggtatgggttcggggtgggcacctatatccccgttactcattccgtacccgtgttttaaaatc |
21956833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 25265261 - 25265225
Alignment:
| Q |
1 |
ataaattgattttctacattcaaaatgagtttgagta |
37 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
25265261 |
ataaattgattttctacattcgagatgagtttgagta |
25265225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University