View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10206_low_6 (Length: 270)
Name: NF10206_low_6
Description: NF10206
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10206_low_6 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 1 - 270
Target Start/End: Complemental strand, 41705273 - 41705004
Alignment:
| Q |
1 |
aactgtggcgatccattctatagacttcgttgcgatcctcattctcaaaagctttactttgacactctcaatggcagttcctatgttgtactaagaatca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
41705273 |
aactgtggcgatccattctatagacttcgttgtgatcctcattctcaaaagctttactttgacactctcaatggcagttcctatgttgtactaagagtca |
41705174 |
T |
|
| Q |
101 |
tgtcttcgatccagcgtatggtgttgcagccaccaccttggttacccggttcatgtgtcacacaagacatgccggtaagcaatggtatttggttaaatca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41705173 |
tgtcttcgatccagcgtatggtgttgcagccaccaccttggttacccggttcatgtgtcacacaagacatgccggtaagcaatggtatttggttaaatca |
41705074 |
T |
|
| Q |
201 |
gtcacttcctttcaacataacttcatccaacacagtgttcattttcaactgttcccctcgtctcttggtt |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41705073 |
gtcacttcctttcaacataacttcatccaacacagtgttcattttcaactgttcccctcgtctcttggtt |
41705004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 52; Significance: 7e-21; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 105 - 200
Target Start/End: Complemental strand, 1453360 - 1453265
Alignment:
| Q |
105 |
ttcgatccagcgtatggtgttgcagccaccaccttggttacccggttcatgtgtcacacaagacatgccggtaagcaatggtatttggttaaatca |
200 |
Q |
| |
|
||||||||| || |||||| ||||||||| |||||||||||| ||||||||||||||||||| |||| ||||||||||| ||||| |||||||| |
|
|
| T |
1453360 |
ttcgatccaacgcatggtggtgcagccacaaccttggttacctggttcatgtgtcacacaaggcatgttggtaagcaatgatatttacttaaatca |
1453265 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 105 - 200
Target Start/End: Complemental strand, 1465052 - 1464957
Alignment:
| Q |
105 |
ttcgatccagcgtatggtgttgcagccaccaccttggttacccggttcatgtgtcacacaagacatgccggtaagcaatggtatttggttaaatca |
200 |
Q |
| |
|
||||||||| || |||||| ||||||||| |||||||||||| ||||||||||||||||||| |||| ||||||||||| ||||| |||||||| |
|
|
| T |
1465052 |
ttcgatccaacgcatggtggtgcagccacaaccttggttacctggttcatgtgtcacacaaggcatgttggtaagcaatgatatttacttaaatca |
1464957 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 137 - 173
Target Start/End: Complemental strand, 7564146 - 7564110
Alignment:
| Q |
137 |
cttggttacccggttcatgtgtcacacaagacatgcc |
173 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
7564146 |
cttggttacctggttcatgtgttacacaagacatgcc |
7564110 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University