View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10207_high_14 (Length: 363)
Name: NF10207_high_14
Description: NF10207
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10207_high_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 331; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 331; E-Value: 0
Query Start/End: Original strand, 20 - 350
Target Start/End: Complemental strand, 55539 - 55209
Alignment:
| Q |
20 |
aacctgaaccaaactctgtccatattttggattacaccacaattcataatatttggtttgtcagagatgtttactgcagttggcctcattgagttcttct |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55539 |
aacctgaaccaaactctgtccatattttggattacaccacaattcataatatttggtttgtcagagatgtttactgcagttggcctcattgagttcttct |
55440 |
T |
 |
| Q |
120 |
acaaacagtccttgaaagggatgcagacattcttcactgccatcacatattgctcctattcatttggattttatctcagctcactattggtttctttggt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55439 |
acaaacagtccttgaaagggatgcagacattcttcactgccatcacatattgctcctattcatttggattttatctcagctcactattggtttctttggt |
55340 |
T |
 |
| Q |
220 |
gaataaaatcacttcaacttctagtggtggtggtggttggcttcatgacaacaatctgaacaaagacaaacttgaccttttctattggttactagctgtc |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55339 |
gaataaaatcacttcaacttctagtggtggtggtggttggcttcatgacaacaatctgaacaaagacaaacttgaccttttctattggttactagctgtc |
55240 |
T |
 |
| Q |
320 |
cttagcttcctcaacttcatcaactatctct |
350 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
55239 |
cttagcttcctcaacttcatcaactatctct |
55209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University