View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10207_high_20 (Length: 329)
Name: NF10207_high_20
Description: NF10207
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10207_high_20 |
 | |
|
| [»] scaffold0174 (1 HSPs) |
| | |
|
| [»] scaffold0092 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0174 (Bit Score: 87; Significance: 1e-41; HSPs: 1)
Name: scaffold0174
Description:
Target: scaffold0174; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 29 - 119
Target Start/End: Complemental strand, 24531 - 24441
Alignment:
| Q |
29 |
tggaagtttttcatttaggggaagttgaatccgtcttcaaggaggtggtgctcgtgcgagttagtgggagcagttggcatttaatgcttcg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
24531 |
tggaagtttttcatttaggggaagttgaatccgtcttcaaggaggtggtgctcgtgcgagttagtgggagcagttggcttttaatgcttcg |
24441 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 69; Significance: 6e-31; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 218 - 318
Target Start/End: Original strand, 21255157 - 21255257
Alignment:
| Q |
218 |
tgttatgcagatacaaacattttcgttagatagttgcatacaaggatttaaatattggcattgtgtaagtgcttattttgtaacgtggtttttccattct |
317 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||| ||||||||| |||||||||||||||||| ||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
21255157 |
tgttatgtggatacaaacattttcattagatagttacatacaaggttttaaatattggcattgtttaagtgcttattttgtaacatggcttttccattct |
21255256 |
T |
|
| Q |
318 |
c |
318 |
Q |
| |
|
| |
|
|
| T |
21255257 |
c |
21255257 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 264 - 314
Target Start/End: Complemental strand, 20984555 - 20984505
Alignment:
| Q |
264 |
tttaaatattggcattgtgtaagtgcttattttgtaacgtggtttttccat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20984555 |
tttaaatattggcattgtgtaagtgcttattttgtaacgtggtttttccat |
20984505 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 83 - 127
Target Start/End: Complemental strand, 26994230 - 26994186
Alignment:
| Q |
83 |
tgcgagttagtgggagcagttggcatttaatgcttcgaattgaaa |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
26994230 |
tgcgagttagtgggagcagttggcatttaatgcttcaaactgaaa |
26994186 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 85 - 114
Target Start/End: Complemental strand, 10287130 - 10287101
Alignment:
| Q |
85 |
cgagttagtgggagcagttggcatttaatg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
10287130 |
cgagttagtgggagcagttggcatttaatg |
10287101 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0092 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0092
Description:
Target: scaffold0092; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 86 - 118
Target Start/End: Complemental strand, 21149 - 21117
Alignment:
| Q |
86 |
gagttagtgggagcagttggcatttaatgcttc |
118 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
21149 |
gagttagtgggagtagttggcatttaatgcttc |
21117 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University