View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10207_high_35 (Length: 240)
Name: NF10207_high_35
Description: NF10207
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10207_high_35 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 32166345 - 32166129
Alignment:
| Q |
1 |
ttgccctagctattagtaattcatttaattgtgtttagggtctcatgttgtgaatatcaattacttcctccggtcttaattgtaagcaaaagtaactaac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
32166345 |
ttgccctagctattagtaattcatttaattgtgtttaggatctcatgttgtgaatatcaattactcccttgagtcttaattgtaagcaaaagtaactaac |
32166246 |
T |
 |
| Q |
101 |
tttaaatttattgagaaatttagttaagtacaaggaatcttgatctcataaaatgtaagtaaattatcaaaagtgttgcaaagagtcttagtttctcttg |
200 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||| || | |||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32166245 |
tttaaacttattgagaaatttagttaagtacaaggaatcttgatctcgta------atgtaaattatcaaaagtgtcgcaaagagtcttagtttctcttg |
32166152 |
T |
 |
| Q |
201 |
attatcttttaatcaatgattaa |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
32166151 |
attatcttttaatcaatgattaa |
32166129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University