View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10207_low_21 (Length: 345)
Name: NF10207_low_21
Description: NF10207
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10207_low_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 105; Significance: 2e-52; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 223 - 331
Target Start/End: Complemental strand, 39753347 - 39753239
Alignment:
| Q |
223 |
tattccttcaattttgttattttcataaggtgttaatcatagtaaaagtttgaccttttaatctgtcttaccaaaatcaaatattcttgtaagaatcata |
322 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39753347 |
tattccttcaattttattattttcataaggtgttaatcatagtaaaagtttgaccttttaatctgtcttaccaaaatcaaatattcttgtaagaatcata |
39753248 |
T |
 |
| Q |
323 |
tataaatat |
331 |
Q |
| |
|
||||||||| |
|
|
| T |
39753247 |
tataaatat |
39753239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University