View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10207_low_25 (Length: 329)
Name: NF10207_low_25
Description: NF10207
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10207_low_25 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 14 - 321
Target Start/End: Original strand, 39753522 - 39753839
Alignment:
| Q |
14 |
taaaactccattagcattaaataattgaactgaatccattacggtgtcctctttagacctcttcttattggcaacataaataaattaagaaggttcttat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
39753522 |
taaaactccattagcattaaataattgaactgaatccattacggtgtcctctttagacctct-------ggcaacataaataaattaagaaggttcttat |
39753614 |
T |
|
| Q |
114 |
ttgattactatatttactaactaacaaaat-----------------gtcatatgtattgtggcaggttcattctctcgaaccgctgttaattatgctgc |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39753615 |
ttgattactatatttactaactaacaaaatactttatgcattaacatgtcatatgtattgtggcaggttcattctctcgaaccgctgttaattatgctgc |
39753714 |
T |
|
| Q |
197 |
tggatgtgaaagtttaatatcaaacattgtgatggccattacagtgatgatatcactgcaatttttgacaaatctattgtattatacaccaattgctatt |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39753715 |
tggatgtgaaagtttaatatcaaacattgtgatggccattacagtgatgatatcactgcaatttttgacaaatctattgtattatacaccaattgctatt |
39753814 |
T |
|
| Q |
297 |
attgcttcagtgattctctctgctc |
321 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
39753815 |
attgcttcagtgattctctctgctc |
39753839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University