View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10207_low_32 (Length: 260)
Name: NF10207_low_32
Description: NF10207
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10207_low_32 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 9 - 224
Target Start/End: Complemental strand, 4046762 - 4046547
Alignment:
| Q |
9 |
aatgaaatgtgattatactatttatgtatagttattaaacttagtgattagttttgatgcacaatcaatgttcatctttttacattgtcaatcaattaca |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4046762 |
aatgaaatgtgattatactatttatgtatagttattaaacttagtgattagttttgatgcacaatcaatgttcatctttttacattgtcaatcaattaca |
4046663 |
T |
 |
| Q |
109 |
aacaccttatgagcactagcaatttaattgtaaacttcgagaacatgatatgtatctatatcaattatgagcacttacaatttaattctggagttgatta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
4046662 |
aacaccttatgagcactagcaatttaattgtaaacttcaagaacatgatatgtatctatatcaattatgagcatttacaatttaattctggagttgatta |
4046563 |
T |
 |
| Q |
209 |
tagatacttacaataa |
224 |
Q |
| |
|
|||| ||||||||||| |
|
|
| T |
4046562 |
tagacacttacaataa |
4046547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University