View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10207_low_33 (Length: 255)
Name: NF10207_low_33
Description: NF10207
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10207_low_33 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 102; Significance: 9e-51; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 1 - 102
Target Start/End: Complemental strand, 4686698 - 4686597
Alignment:
| Q |
1 |
ttatggtgatgggagagatgcgcaagtctttcaaggattctcttaaagctcttgaagctgatattcaatttgccaatacactgtaaaatttcttgaattc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4686698 |
ttatggtgatgggagagatgcgcaagtctttcaaggattctcttaaagctcttgaagctgatattcaatttgccaatacactgtaaaatttcttgaattc |
4686599 |
T |
|
| Q |
101 |
cc |
102 |
Q |
| |
|
|| |
|
|
| T |
4686598 |
cc |
4686597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 213 - 241
Target Start/End: Complemental strand, 4686490 - 4686462
Alignment:
| Q |
213 |
atgattgctgaaatatggagtaatctgtg |
241 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
4686490 |
atgattgctgaaatatggagtaatctgtg |
4686462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 57; Significance: 7e-24; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 18 - 86
Target Start/End: Complemental strand, 24968493 - 24968425
Alignment:
| Q |
18 |
atgcgcaagtctttcaaggattctcttaaagctcttgaagctgatattcaatttgccaatacactgtaa |
86 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
24968493 |
atgcgaaagtctttcaaggattctctcaaagctcttgaagctgatattcaatttgctaatacactgtaa |
24968425 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University