View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10207_low_33 (Length: 255)

Name: NF10207_low_33
Description: NF10207
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10207_low_33
NF10207_low_33
[»] chr4 (2 HSPs)
chr4 (1-102)||(4686597-4686698)
chr4 (213-241)||(4686462-4686490)
[»] chr7 (1 HSPs)
chr7 (18-86)||(24968425-24968493)


Alignment Details
Target: chr4 (Bit Score: 102; Significance: 9e-51; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 1 - 102
Target Start/End: Complemental strand, 4686698 - 4686597
Alignment:
1 ttatggtgatgggagagatgcgcaagtctttcaaggattctcttaaagctcttgaagctgatattcaatttgccaatacactgtaaaatttcttgaattc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4686698 ttatggtgatgggagagatgcgcaagtctttcaaggattctcttaaagctcttgaagctgatattcaatttgccaatacactgtaaaatttcttgaattc 4686599  T
101 cc 102  Q
    ||    
4686598 cc 4686597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 213 - 241
Target Start/End: Complemental strand, 4686490 - 4686462
Alignment:
213 atgattgctgaaatatggagtaatctgtg 241  Q
    |||||||||||||||||||||||||||||    
4686490 atgattgctgaaatatggagtaatctgtg 4686462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 57; Significance: 7e-24; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 18 - 86
Target Start/End: Complemental strand, 24968493 - 24968425
Alignment:
18 atgcgcaagtctttcaaggattctcttaaagctcttgaagctgatattcaatttgccaatacactgtaa 86  Q
    ||||| |||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||    
24968493 atgcgaaagtctttcaaggattctctcaaagctcttgaagctgatattcaatttgctaatacactgtaa 24968425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University