View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10207_low_34 (Length: 255)
Name: NF10207_low_34
Description: NF10207
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10207_low_34 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 30 - 239
Target Start/End: Complemental strand, 4835119 - 4834912
Alignment:
| Q |
30 |
cgcaaggatgcttggcatctatatcatcaatagctggtatgcctacaacttcctcgcagagcgagcgccacttttcagcaactgcaggaaaggttgcaat |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4835119 |
cgcaaggatgcttggcatctatatcatcaatagctggtatgcctacaacttcctcgcagagcgagcgccacttttcagcaactgcaggaaaggttgcaat |
4835020 |
T |
|
| Q |
130 |
ttactcctacgctgacaaccttgaattttctgttgtttttgttaccatatattaaagaaaaacttgatgttgannnnnnngttgctatgttatgcaaaat |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
4835019 |
ttactcctacgctgacaaccttgaattttctgttgtttttgttacc--atattaaagaaaaacttgaggttgatttttttgttgctatgttatgcaaaat |
4834922 |
T |
|
| Q |
230 |
gaggggggag |
239 |
Q |
| |
|
|||||||||| |
|
|
| T |
4834921 |
gaggggggag |
4834912 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University