View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10207_low_36 (Length: 250)
Name: NF10207_low_36
Description: NF10207
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10207_low_36 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 11 - 241
Target Start/End: Original strand, 45514804 - 45515034
Alignment:
| Q |
11 |
ctcatgttgttttgtaacagtaacttcggaaaaatgtaacataaccaacactctacatatgtaaaccatagtgatacatgtatgaatggttatattttct |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45514804 |
ctcatgttgttttgtaacagtaacttcggaaaaatgtaacataaccaacactctacatatgtaaaccatagtgatacatgtatgaatggttatattttct |
45514903 |
T |
|
| Q |
111 |
tatttgaaatgtaacattcaattagacaaataatgtcaacaaattattggccattttggcttataataacaacgatgaaaataaagctttaacagaattt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45514904 |
tatttgaaatgtaacattcaattagacaaataatgtcaacaaattattggccattttggcttataataacaacgatgaaaataaagctttaacagaattt |
45515003 |
T |
|
| Q |
211 |
tattgtcgggacaatgctgtagccctctctg |
241 |
Q |
| |
|
||||| |||||||||| |||||||||||||| |
|
|
| T |
45515004 |
tattgccgggacaatgttgtagccctctctg |
45515034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University