View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10207_low_39 (Length: 241)
Name: NF10207_low_39
Description: NF10207
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10207_low_39 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 4686713 - 4686936
Alignment:
| Q |
1 |
tcttcttcttttcactttttcacaataatataaaactcaatgaaaccctctcatgataaaattcacttcactcataaacatgaaccgttattcttttttg |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
4686713 |
tcttcttgttttcactttttcacaataatataaaactcaatgaaaccctctcatgataaaattcacttcactcaaaaacatgaaccgttattcttttttg |
4686812 |
T |
|
| Q |
101 |
ttgcgaaaaaatagccactaagataaagcactcaaaagaagagagaattttttagagtgagattaggaagagaaaaaagtataataataaaaaattcttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4686813 |
ttgcgaaaaaatagccactaagataaagcactcaaaagaagagagaattttttagagtgagattaggaagagaaaaaagtataataataaaaaattcttt |
4686912 |
T |
|
| Q |
201 |
gaaggggttttgtgggttttggct |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
4686913 |
gaaggggttttgtgggttttggct |
4686936 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University