View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10207_low_41 (Length: 241)
Name: NF10207_low_41
Description: NF10207
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10207_low_41 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 17 - 241
Target Start/End: Original strand, 45514317 - 45514538
Alignment:
| Q |
17 |
aagacacccccacttatatcataagtagtcgataagttacttggnnnnnnnnnnnnnnnnnnngtaactggatggatcatctcagaacatctccccttaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45514317 |
aagacacccccacttatatcataagtagtcgataagttacttggaaaaaaaaaaaaaaaa---gtaactggatggatcatctcagaacatctccccttaa |
45514413 |
T |
|
| Q |
117 |
tctaatgattccaaatatttaccatttttctcagccctttaaacctttcaatattcaaaaaggtttatgaatgttggttacgggctcttctacaaaaagg |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45514414 |
tctaatgattccaaatatttaccatttttctcaaccctttaaacctttcaatattcaaaaaggtttatgaatgttggttacgggctcttctacaaaaagg |
45514513 |
T |
|
| Q |
217 |
ggaattttttaaattttcaagcaac |
241 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
45514514 |
ggaattttttaaattttcaagcaac |
45514538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University