View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10207_low_50 (Length: 229)
Name: NF10207_low_50
Description: NF10207
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10207_low_50 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 32181856 - 32181634
Alignment:
| Q |
1 |
ctcaaaatgtattaatggggaagagtcggtcattttgaaaaccgagggactataatggtggaattagatatggagggaccaaaaaatcatgaataaggct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32181856 |
ctcaaaatgtattaatggggaagagtcggtcattttgaaaaccgagggactataatagtggaattagatatggagggaccaaaaaatcatgaataaggca |
32181757 |
T |
|
| Q |
101 |
aaataaatggaccaaaattgattttaagtctaaaataatgcatctgaaactattgagaatatattgcacataatctaagagtaagaggtagctagctacc |
200 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32181756 |
aaataaattgaccaaaattgattttaagtctaaaataatgcatctgaaactattgagaatatattgcacataatctaagagtaagaggtagctagctacc |
32181657 |
T |
|
| Q |
201 |
ttggctgtgaagacagtgagaga |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
32181656 |
ttggctgtgaagacagtgagaga |
32181634 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University