View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10207_low_53 (Length: 226)
Name: NF10207_low_53
Description: NF10207
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10207_low_53 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 134 - 206
Target Start/End: Original strand, 14171974 - 14172046
Alignment:
| Q |
134 |
atgacgaaagcgggagtaagacataaaagtgtttaggctctgaagatctttcagactctaaaggtcaacatct |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14171974 |
atgacgaaagcgggagtaagacataaaagtgtttaggctctgaagatctttcagactctaaaggtcaacatct |
14172046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 15 - 90
Target Start/End: Original strand, 14171855 - 14171930
Alignment:
| Q |
15 |
cagagacgtcagagtgaaattaaagttgaactagtcaaaaggcaagaggaattgcttctgaatatttcgtattatg |
90 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14171855 |
cagaaacgtcagagtgaaattcaagttgaactagtcaaaaggcaagaggaattgcttctgaatatttcgtattatg |
14171930 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University