View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10207_low_54 (Length: 224)
Name: NF10207_low_54
Description: NF10207
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10207_low_54 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 9 - 218
Target Start/End: Original strand, 36809832 - 36810038
Alignment:
| Q |
9 |
attactttggtacatctgtggaaacaccttaattgatgaaggcgatctggttggaaatgcgtggtagtactactactatgtggatgagaaagaatgtaat |
108 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
36809832 |
attactttggtacaactttggaaacaccttaattgatgaaggcgatctggttggaaatgcgtggta---ctaccactatgtggatgagaaagaatgtaat |
36809928 |
T |
 |
| Q |
109 |
attgactatctgctagggtattcttgcatccatctgtctactctcaaattctccatattaattccaataactacactgacatgccgcataacgtaaatag |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| | |||||| |
|
|
| T |
36809929 |
attgactatctgctagggtattcttgcatccatctgtctactctcaaattctccatattaattccaataactacactgacatgacgcataatggaaatag |
36810028 |
T |
 |
| Q |
209 |
gccacaaacc |
218 |
Q |
| |
|
|| ||||||| |
|
|
| T |
36810029 |
gcaacaaacc |
36810038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University