View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10207_low_56 (Length: 217)
Name: NF10207_low_56
Description: NF10207
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10207_low_56 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 14 - 201
Target Start/End: Complemental strand, 31165042 - 31164855
Alignment:
| Q |
14 |
gacgtaggaaacgaaacattagagctcctgccacagctcctccacttggggctaagatgtatatccaaatattcttaaatttccatgacacaattgctgg |
113 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31165042 |
gacgtaggaaatgaaacattagagctcctgccacagctcctccacttggggctaagatgtatatccaaatattcttaaatttccatgacacaattgctgg |
31164943 |
T |
 |
| Q |
114 |
accaagtgatcttgcaggattcattgatccacctgacacagggctgcaacaaaaattaaattaaattactttgttactagataaaaat |
201 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
31164942 |
accaagtgatcttgctggattcattgatccacctgacacagggctgcaacaaaaattaaattaaattacttcgttactagataaaaat |
31164855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University