View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10207_low_57 (Length: 216)
Name: NF10207_low_57
Description: NF10207
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10207_low_57 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 25 - 205
Target Start/End: Original strand, 35778998 - 35779178
Alignment:
| Q |
25 |
ctctctttcttcccttaaaaaatgaatcaataatatatgtttggacgttgtgttaactaaaataaatgaacatggtcgaatatgccttgaaagctggttt |
124 |
Q |
| |
|
|||||| ||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35778998 |
ctctctctctccccttaaaaaatgaatcaataatatatttttggacgttgtgttaactaaaataaatgaacatggtcgaatatgccttgaaagctggttt |
35779097 |
T |
 |
| Q |
125 |
tcactcttggatgttggcttatgcacagagcgtatcgacccatgcgcaacgggcacacatgcgtttaatctataaattcat |
205 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||||||||||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
35779098 |
tcactcttggatgttgccttatgcacggagcgtatcgacccatgcacaacgggcacacatgcgtttaatatataaattcat |
35779178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University