View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10208_low_11 (Length: 205)
Name: NF10208_low_11
Description: NF10208
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10208_low_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 69 - 185
Target Start/End: Original strand, 10195753 - 10195869
Alignment:
| Q |
69 |
ctaacaaatagtgattttacaatgcagaggatactacagatgcacacatagacatgcacaaggttgtctagctactaagcaagtgcaaaaatcagatgaa |
168 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10195753 |
ctaacagatagtgattttgcaatgcagaggatactacagatgcacacatagacatgcacaaggttgtctagctactaagcaagtgcaaaaatcagatgaa |
10195852 |
T |
 |
| Q |
169 |
gatgagatgatatgtga |
185 |
Q |
| |
|
||||| ||||||||||| |
|
|
| T |
10195853 |
gatgaaatgatatgtga |
10195869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 91 - 171
Target Start/End: Complemental strand, 48411195 - 48411115
Alignment:
| Q |
91 |
tgcagaggatactacagatgcacacatagacatgcacaaggttgtctagctactaagcaagtgcaaaaatcagatgaagat |
171 |
Q |
| |
|
|||||||| || |||||||||||||||||| ||| |||||| || ||||| || |||||||| |||| |||||||||||| |
|
|
| T |
48411195 |
tgcagagggtattacagatgcacacatagaaatggacaaggatgcctagcaacaaagcaagttcaaaggtcagatgaagat |
48411115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University