View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10209_low_8 (Length: 247)
Name: NF10209_low_8
Description: NF10209
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10209_low_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 36 - 230
Target Start/End: Original strand, 12999029 - 12999223
Alignment:
| Q |
36 |
gaattgctgataaaagtgtgtataatgcaaatgctacatgtactcgaaagggaattaaactaaaatgcacaacacatgcatgcatatatagctttttaat |
135 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12999029 |
gaatggctgataaaagtgtatataatgcaaatgttacatgtactcgaaagggaattaaactaaaatgcacaacacatgcatgcatatatagctttttaat |
12999128 |
T |
|
| Q |
136 |
tagggtttcaaagatgtttttctttatcatacttttcttcgtatgttcctaattgatgaacatgattagttgattagggcaaaggagcagtgatg |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12999129 |
tagggtttcaaagatgtttttctttatcatacttttcttcgtatgttcctaattgatgaacatgattagttgattagggcaaaggagcagtgatg |
12999223 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University