View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1020_high_2 (Length: 270)
Name: NF1020_high_2
Description: NF1020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1020_high_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 34 - 195
Target Start/End: Original strand, 40126865 - 40127027
Alignment:
| Q |
34 |
tctgcagagattagtcatcgaaaatattggtggattacttcgcaccaataacatggttaccattcttcttcnnnnnnnn-aatacgataaccttatcatt |
132 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||| |||| ||||||||||||||| |
|
|
| T |
40126865 |
tctgcagagattagtcatcgaaaatattggtggattacttcgcaccaataacatggttaccgtttttcttttttttttttaataagataaccttatcatt |
40126964 |
T |
 |
| Q |
133 |
ttgtttaacagtctattcatgtttatggccacacattaattgaattgtgattagaaaacagag |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40126965 |
ttgtttaacagtctattcatgtttatggccacacattaattgaattgtgattagaaaacagag |
40127027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University