View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1020_high_3 (Length: 264)
Name: NF1020_high_3
Description: NF1020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1020_high_3 |
 |  |
|
| [»] scaffold0066 (3 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0066 (Bit Score: 113; Significance: 3e-57; HSPs: 3)
Name: scaffold0066
Description:
Target: scaffold0066; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 78 - 198
Target Start/End: Original strand, 33537 - 33657
Alignment:
| Q |
78 |
atgaaaagaagtaatagaattgtccaaattctgatactctttgggttttggggagccattgaaggctgaggtgcatgccgtgatgtctaaaagtctccga |
177 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33537 |
atgaaaagaagtcatagaattgtccaaattctgatactctttgggttttggggagccattgaaggctgaggtgcatgccgtgatgtctaaaagtctccga |
33636 |
T |
 |
| Q |
178 |
atatgcgtcactgccacctct |
198 |
Q |
| |
|
||||||||||| ||||||||| |
|
|
| T |
33637 |
atatgcgtcacagccacctct |
33657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0066; HSP #2
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 116 - 228
Target Start/End: Original strand, 31218 - 31330
Alignment:
| Q |
116 |
ctttgggttttggggagccattgaaggctgaggtgcatgccgtgatgtctaaaagtctccgaatatgcgtcactgccacctcttccgtgtcatactcctc |
215 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||| |
|
|
| T |
31218 |
ctttgggttttggggagccattgaaggttgaggtgcatgccgtgatgtctaaaagtctccgaatatgcgtcaccgccacctcttccgtgttgtactcctc |
31317 |
T |
 |
| Q |
216 |
tgaaaaataacaa |
228 |
Q |
| |
|
||||||||||||| |
|
|
| T |
31318 |
tgaaaaataacaa |
31330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0066; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 61 - 104
Target Start/End: Original strand, 31114 - 31157
Alignment:
| Q |
61 |
aggtgtaagatgggagaatgaaaagaagtaatagaattgtccaa |
104 |
Q |
| |
|
||||||||| ||||| ||||||||||||| |||||||||||||| |
|
|
| T |
31114 |
aggtgtaaggtgggaaaatgaaaagaagtcatagaattgtccaa |
31157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University