View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1020_low_11 (Length: 252)
Name: NF1020_low_11
Description: NF1020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1020_low_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 21139613 - 21139388
Alignment:
| Q |
1 |
cgcatctcgaataatatggaccaaacgatcatgaaacctttgcgaagatgtgaaaccctcgtgagaaatctctaacggcaacgatgaatccgtcgttttg |
100 |
Q |
| |
|
|||||||| || |||| ||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
21139613 |
cgcatctccaacaataaggaccaaacgaccttgaaacctttgcgaagatgtgaaaccctcgtgagaaatctctaacggcgacgatgaatccgtcattttg |
21139514 |
T |
 |
| Q |
101 |
tgagtttggagaatcgggcgatttttcatgccagaccgcacggtggacaccatctgtacttgcggtgagcacaacagtagagactttgccgacgatgtac |
200 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
21139513 |
tgagtttggagaatcgggcgattcttcatgccataccgcacggtggacaccatctgtacttgcggtgagcacaacagtagagactatgccggcgatgtac |
21139414 |
T |
 |
| Q |
201 |
caggtgtgatgaaatgtgagaagtgg |
226 |
Q |
| |
|
|||||||| ||||||||||||||||| |
|
|
| T |
21139413 |
caggtgtggtgaaatgtgagaagtgg |
21139388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University