View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1020_low_8 (Length: 269)
Name: NF1020_low_8
Description: NF1020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1020_low_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 202; Significance: 1e-110; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 30 - 255
Target Start/End: Complemental strand, 594238 - 594013
Alignment:
| Q |
30 |
gtttctcctctcaaattctacccccaatatttttaaatgaaacttctaatctggttaattgttattgatttactatttactatgtgcaatgacacttcta |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
594238 |
gtttctcctctcaaattctacccccaatatttttaaatgaaacttctaatctggttaagtgttattgatttactatttactatgtgcaatgacacttcta |
594139 |
T |
|
| Q |
130 |
atcgaagacatgtcgtgtgtctgacacgtcaaccaccagacacatgcgcttatattgaattatatcatttcttttacattagtttattgattatgattgg |
229 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
594138 |
atcgaagacatgtcgtgtgtctaaaacgtcaaccaccagacacatgcacttatattgaattatatcatttcttttacattattttattgattttgattgg |
594039 |
T |
|
| Q |
230 |
tcagcattcgtgtcttgtccggtgtc |
255 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
594038 |
tcagcattcgtgtcttgtccggtgtc |
594013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 166 - 255
Target Start/End: Original strand, 578325 - 578414
Alignment:
| Q |
166 |
cagacacatgcgcttatattgaattatatcatttcttttacattagtttattgattatgattggtcagcattcgtgtcttgtccggtgtc |
255 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||| ||| |||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
578325 |
cagacacatgcgattatattgaattatatcatttcttttacattattttcttgattttgattggtcagcattcgtgtcatgtccggtgtc |
578414 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 78 - 125
Target Start/End: Original strand, 578261 - 578308
Alignment:
| Q |
78 |
atctggttaattgttattgatttactatttactatgtgcaatgacact |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
578261 |
atctggttaattgttattgatttactatttactatgtgcaatgacact |
578308 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University