View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10210_low_16 (Length: 226)
Name: NF10210_low_16
Description: NF10210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10210_low_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 15 - 208
Target Start/End: Complemental strand, 30007946 - 30007753
Alignment:
| Q |
15 |
cataggatattccatcatttaatgcatgatccacgtctatatgacacccacattcctcacagaaatataacaattgtaccgtatgtcatatgaaactggg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30007946 |
cataggatattccatcatttaatgcatgatccacgtctatatgacacccacattcctcacagaaatataacaattgtaccgtatgtcatatgaaactggg |
30007847 |
T |
 |
| Q |
115 |
aaccaaatttcaccagcaaaaccatccaaagccatattacctatcgaaacaaactcatgtcaactacctgccatgtcctcatccgaggcaaatc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30007846 |
aaccaaatttcaccagcaaaaccatccaaagccatattgcctatcgaaacaaactcatgtcaactacctgccatgtcctcatccgaggcaaatc |
30007753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University