View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10210_low_17 (Length: 215)
Name: NF10210_low_17
Description: NF10210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10210_low_17 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 22 - 215
Target Start/End: Complemental strand, 40333538 - 40333345
Alignment:
| Q |
22 |
atttcattagagatcattttagactatgtcgtcaaaatttattctgactagtcctttcccttggttctgatcagagagaggccatgcgatgaacttgttg |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
40333538 |
atttcattagagatcattttagactatgtcgttaaaatttattctgactagtcttttcccttggttctgatcagggagaggcgatgcgatgaacttgttg |
40333439 |
T |
 |
| Q |
122 |
gcgttgaagtggtgtggtagcatgtctttcgaacgtcatttttggagatgtatggaaaatgctaaaatatacgacaaaatttgtcgtcagattt |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
40333438 |
gcgttgaagtggtgtggtagcatgtctttcgaacgtcatttttggagatgtatacaaaatgctaaaatacacgacaaaatttgtcgtcatattt |
40333345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 175 - 215
Target Start/End: Original strand, 13066482 - 13066522
Alignment:
| Q |
175 |
ggaaaatgctaaaatatacgacaaaatttgtcgtcagattt |
215 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
13066482 |
ggaaaatgctaaaatacacgacaaaatttgtcgacagattt |
13066522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University