View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10210_low_17 (Length: 215)

Name: NF10210_low_17
Description: NF10210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10210_low_17
NF10210_low_17
[»] chr4 (1 HSPs)
chr4 (22-215)||(40333345-40333538)
[»] chr7 (1 HSPs)
chr7 (175-215)||(13066482-13066522)


Alignment Details
Target: chr4 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 22 - 215
Target Start/End: Complemental strand, 40333538 - 40333345
Alignment:
22 atttcattagagatcattttagactatgtcgtcaaaatttattctgactagtcctttcccttggttctgatcagagagaggccatgcgatgaacttgttg 121  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||| ||||||| |||||||||||||||||    
40333538 atttcattagagatcattttagactatgtcgttaaaatttattctgactagtcttttcccttggttctgatcagggagaggcgatgcgatgaacttgttg 40333439  T
122 gcgttgaagtggtgtggtagcatgtctttcgaacgtcatttttggagatgtatggaaaatgctaaaatatacgacaaaatttgtcgtcagattt 215  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||| ||||||||||||||||||| ||||    
40333438 gcgttgaagtggtgtggtagcatgtctttcgaacgtcatttttggagatgtatacaaaatgctaaaatacacgacaaaatttgtcgtcatattt 40333345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 175 - 215
Target Start/End: Original strand, 13066482 - 13066522
Alignment:
175 ggaaaatgctaaaatatacgacaaaatttgtcgtcagattt 215  Q
    |||||||||||||||| |||||||||||||||| |||||||    
13066482 ggaaaatgctaaaatacacgacaaaatttgtcgacagattt 13066522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University