View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10210_low_9 (Length: 290)
Name: NF10210_low_9
Description: NF10210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10210_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 1 - 278
Target Start/End: Original strand, 56043339 - 56043616
Alignment:
| Q |
1 |
attctcatgcaaatcgctgttcttcccatcggaaagttcatggccgccactcttcccaccaaagagtataacttttttgggcggtggcgtttcacgttga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56043339 |
attctcatgcaaatcgctgttcttcccatcggaaagttcatggccgccactcttcccaccaaagagtataacttttttgggcggtggcgtttcacgttga |
56043438 |
T |
|
| Q |
101 |
atcctggtccgtttaatatgaaggagcatgttattatcactatttttgctaactgtggtgtttctcaaggtggtggtgatgcttactccattggtgctat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56043439 |
atcctggtccgtttaatatgaaggagcatgttattatcactatttttgctaactgtggtgtttctcaaggtggtggtgatgcttactccattggtgctat |
56043538 |
T |
|
| Q |
201 |
tactattatgaaagcttattacaaacaatctctcagttttctccttgctctattcatcgtcttaaccacacaggttct |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56043539 |
tactattatgaaagcttattacaaacaatctctcagttttctccttgctctattcatcgtcttaaccacacaggttct |
56043616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University