View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10211_high_12 (Length: 372)
Name: NF10211_high_12
Description: NF10211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10211_high_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 18 - 364
Target Start/End: Original strand, 49673024 - 49673360
Alignment:
| Q |
18 |
gtacgtggcatcatgaactggtcacctcaccttaactctcacttctacgttggattgatacagtggaataagaattctgtaagcgaggacttgcccttct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49673024 |
gtacgtggcatcatgaactggtcacctcaccttaactctcacttctacgttggattgatacagtggaataagaattctgtaagcgaggacttgcccttct |
49673123 |
T |
 |
| Q |
118 |
tgcaagataaccttttctctaacaaattccactagtctttcttatttcaagtcaacttgcgtattaggtggttcaatacggggatatattgtggaagtta |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49673124 |
tgcaagataaccttttctctaacaaattccactagtctttcttatttcaagtcaacttgcgtattaggtggttcaatacggggatatattgtggaagtta |
49673223 |
T |
 |
| Q |
218 |
aagagtgaactacaacacactttcattagtgaatcacattacaatctctacctataaagtgggggattttcttgaaacttgttgcttattttccaccact |
317 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
49673224 |
aagagtgaagtacaacacactttcattagtgaatcacattacaatctctacctataaagtgggggattttc----------ttgcttattttccaccact |
49673313 |
T |
 |
| Q |
318 |
gtttccgtatcttggctttgcaatacacaatgaacccccttttcatt |
364 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
49673314 |
gtttccgtatcttggccttgcaatacacaatgaacccccttttcatt |
49673360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University