View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10211_high_25 (Length: 250)
Name: NF10211_high_25
Description: NF10211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10211_high_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 139; Significance: 8e-73; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 61 - 240
Target Start/End: Original strand, 26895158 - 26895333
Alignment:
| Q |
61 |
tttgtatgacgtttgcttaccatacagctaccaatcataaaaatatggctttaatctacattgtcagtgctatgcaggaagtatctgtttagtggaaagt |
160 |
Q |
| |
|
||||||| ||||||||||| |||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
26895158 |
tttgtataacgtttgcttatcatacatctaccaatcata----tatggctttaatctacattgtcagtgctatgcaggaagtatcagtttagtggaaagt |
26895253 |
T |
 |
| Q |
161 |
tgctgatatattgaactaagatacagatagtgtattaagtaaggcttggtagcactccttcctaatccatataacctttg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
26895254 |
tgctgatatattgaactaagatacagatggtgtattaagtaaggcttggtagcactccttcctaatccatataacttttg |
26895333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University