View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10211_high_30 (Length: 239)
Name: NF10211_high_30
Description: NF10211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10211_high_30 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 48177145 - 48177362
Alignment:
| Q |
1 |
atgtttggcgggatgacaaaaatcataattactagcgtaatcaaaacaaaaaacatgtcatgtgtgctcgtgactgattgatgaaatgttccttcgtggc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
48177145 |
atgtttggcgggatgacaaaaatcataattcctagcgtaatcaaaacaaaa-acatgtcatgtgtgctcgtgactgattgatgaaaggttccttcgtggc |
48177243 |
T |
|
| Q |
101 |
aaataacattgttttcttcatattcatcttaattaagttatgttgcatttggaccatgggnnnnnnnaagaacttcctttnnnnnnncacacgcacatga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
48177244 |
aaataacattgttttcttcatattcatc----ttaagttatgttgcatttggaccatgggtttttttaagaacttcctttaaaaaaacacacgcacatga |
48177339 |
T |
|
| Q |
201 |
cagtttagtattaggtggcttat |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
48177340 |
cagtttagtattaggtggcttat |
48177362 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University