View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10211_high_37 (Length: 203)
Name: NF10211_high_37
Description: NF10211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10211_high_37 |
 | |
|
| [»] scaffold0464 (1 HSPs) |
| | |
|
Alignment Details
Target: chr3 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 16 - 184
Target Start/End: Original strand, 12735517 - 12735685
Alignment:
| Q |
16 |
atgaaggacggactctccagcaaacgacttactggaatgggtatgagactgtaatcaaagttgcccttgtctggtactcggaatgatctaagcaaaaggt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
12735517 |
atgaaggacggactctccagcaaacgacttacaggaatggatatgagactgtaatcaaagttgccccagtctggtactcggaatgatcttagcaaaaggt |
12735616 |
T |
|
| Q |
116 |
gggtgttccgaggcgatcgctgaaggtgcagtttagcgaaggaaggatcatgagagattagggttttcc |
184 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12735617 |
gggtgttccgaggcgatcgccgaaggtgcagtttagcgaaggaaggatcatgagagattagggttttcc |
12735685 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 112 - 184
Target Start/End: Original strand, 32579655 - 32579727
Alignment:
| Q |
112 |
aggtgggtgttccgaggcgatcgctgaaggtgcagtttagcgaaggaaggatcatgagagattagggttttcc |
184 |
Q |
| |
|
|||||||||||||| |||||||| ||||| || | ||| |||||| ||||||| ||| ||||||||||||| |
|
|
| T |
32579655 |
aggtgggtgttccgtggcgatcgatgaagatgaaatttggcgaagacgggatcatcagaaattagggttttcc |
32579727 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0464 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: scaffold0464
Description:
Target: scaffold0464; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 22 - 184
Target Start/End: Complemental strand, 7407 - 7245
Alignment:
| Q |
22 |
gacggactctccagcaaacgacttactggaatgggtatgagactgtaatcaaagttgcccttgtctggtactcggaatgatctaagcaaaaggtgggtgt |
121 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||| | ||||| |||||||| |||| |||||||||||||||| |
|
|
| T |
7407 |
gacggactctccagcaaacgacttacaggaatggatatgagactgtaatcaaagttgccccagcctggttctcggaataatcttagcaaaaggtgggtgt |
7308 |
T |
|
| Q |
122 |
tccgaggcgatcgctgaaggtgcagtttagcgaaggaaggatcatgagagattagggttttcc |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7307 |
tccgaggcgatcgctgaaggtgcagtttagcgaaggaaggatcatgagagattagggttttcc |
7245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 49; Significance: 3e-19; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 112 - 184
Target Start/End: Complemental strand, 19778879 - 19778807
Alignment:
| Q |
112 |
aggtgggtgttccgaggcgatcgctgaaggtgcagtttagcgaaggaaggatcatgagagattagggttttcc |
184 |
Q |
| |
|
||||| |||||||| ||||||||||||| |||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
19778879 |
aggtgtgtgttccgctgcgatcgctgaagatgcagtttggcgaaggaaggatcatgagaaattagggttttcc |
19778807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 112 - 184
Target Start/End: Original strand, 19888504 - 19888576
Alignment:
| Q |
112 |
aggtgggtgttccgaggcgatcgctgaaggtgcagtttagcgaaggaaggatcatgagagattagggttttcc |
184 |
Q |
| |
|
||||| |||||||| ||||| |||||||| || ||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
19888504 |
aggtgtgtgttccgcggcgaacgctgaagatggagtttggcgaaggaaggatcatgagaaattagggttttcc |
19888576 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 112 - 180
Target Start/End: Original strand, 19351793 - 19351861
Alignment:
| Q |
112 |
aggtgggtgttccgaggcgatcgctgaaggtgcagtttagcgaaggaaggatcatgagagattagggtt |
180 |
Q |
| |
|
|||||||||||||| |||| || | |||||||| ||| | |||||||||||||||||| || |||||| |
|
|
| T |
19351793 |
aggtgggtgttccgtcgcgaccggtaaaggtgcaatttggtgaaggaaggatcatgagaaatcagggtt |
19351861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 128 - 184
Target Start/End: Complemental strand, 14748657 - 14748602
Alignment:
| Q |
128 |
gcgatcgctgaaggtgcagtttagcgaaggaaggatcatgagagattagggttttcc |
184 |
Q |
| |
|
||||||||||||| |||| ||| || ||||||||||||||||| ||||||||||||| |
|
|
| T |
14748657 |
gcgatcgctgaagatgca-tttggcaaaggaaggatcatgagaaattagggttttcc |
14748602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 114 - 183
Target Start/End: Original strand, 18921488 - 18921554
Alignment:
| Q |
114 |
gtgggtgttccgaggcgatcgctgaaggtgcagtttagcgaaggaaggatcatgagagattagggttttc |
183 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||| |||||||||| |||||| |||||||||||| |
|
|
| T |
18921488 |
gtgggtgttccgcggcgatcgatgaaggtgcattttgacgaaggaagg---atgagaaattagggttttc |
18921554 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University