View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10211_low_10 (Length: 496)
Name: NF10211_low_10
Description: NF10211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10211_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 3e-95; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 3e-95
Query Start/End: Original strand, 279 - 480
Target Start/End: Complemental strand, 51844413 - 51844212
Alignment:
| Q |
279 |
cttggaattgggtagccacaaacggaaacatgaaagttgtcatcgtgtgtgagaacagattggtgatggaggcttcaacttttagaattaccaatattgg |
378 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51844413 |
cttggaattgggtagccacaaacggaaacatgaaagttgtcatcgtgtgtgagaacagattggtgatggaggcttcaacttttagaattaccaatattgg |
51844314 |
T |
 |
| Q |
379 |
attttaattctaattatagttaaatttacaattggattgaattcattcagannnnnnngctatttttaacatcttctattcgttgaccggctaccttcat |
478 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51844313 |
attttaattctaattatagttaaatttacaattggattcaattcattcagatttttttgctatttttaacatcttctattcgttgaccggctaccttcat |
51844214 |
T |
 |
| Q |
479 |
tt |
480 |
Q |
| |
|
|| |
|
|
| T |
51844213 |
tt |
51844212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 82; E-Value: 2e-38
Query Start/End: Original strand, 105 - 186
Target Start/End: Complemental strand, 51844587 - 51844506
Alignment:
| Q |
105 |
cgaacagcggccattggcaaccgggaatctgaaacgtcctccggttgtttgtagaaatggaccgctgttcggagagatagag |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51844587 |
cgaacagcggccattggcaaccgggaatctgaaacgtcctccggttgtttgtagaaatggaccgctgttcggagagatagag |
51844506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University