View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10211_low_18 (Length: 419)
Name: NF10211_low_18
Description: NF10211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10211_low_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 206; Significance: 1e-112; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 191 - 404
Target Start/End: Complemental strand, 7544777 - 7544564
Alignment:
| Q |
191 |
ggtcttaacagtgtgttaggtggggctttatttgttactactgttgtggttggaactgtttctctttgtgttgcagagagggatgttcaagttgatcgac |
290 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7544777 |
ggtcttaacagtgtgttaggtggggctttgtttgttactactgttgtggttggaactgtttctctttgtgttgcagagagggatgttcaagttgatcgac |
7544678 |
T |
 |
| Q |
291 |
gatgctttataagggatttgagtttctccctgttcactattttttcgctgcttttgattttgtttgttggcaagattggtattggggcagcgattggttt |
390 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7544677 |
gatgctttataagggatttgagtttcttcctgttcactattttttcgctgcttttgattttgtttgttggcaagattggtattggggcagcgattggttt |
7544578 |
T |
 |
| Q |
391 |
tgtatcgatttatg |
404 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
7544577 |
tgtatcgatttatg |
7544564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University