View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10211_low_21 (Length: 403)
Name: NF10211_low_21
Description: NF10211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10211_low_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 375; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 375; E-Value: 0
Query Start/End: Original strand, 18 - 396
Target Start/End: Complemental strand, 46264288 - 46263910
Alignment:
| Q |
18 |
ctcaacaattcaggcaggttggcttgttttccctcaactacacgttactatcatttgcgggattgggacctttcactttcattacttcttgtaacttgtg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46264288 |
ctcaacaattcaggcaggttggcttgttttccctcaactacaagttactatcatttgcgggattgggacctttcactttcattacttcttgtaacttgtg |
46264189 |
T |
 |
| Q |
118 |
ttgtttaaattttgtagtgttattgttaaagcagataagaaacttttgactgtacagtttcccgatggtcatgagggacgggctttcacacttaaggtac |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46264188 |
ttgtttaaattttgtagtgttattgttaaagcagataagaaacttttgactgtacagtttcccgatggtcatgagggacgggctttcacacttaaggtac |
46264089 |
T |
 |
| Q |
218 |
ttaaatcttcttttacatatcctatatttcaagagatgcctttctcataaagatgttagaattggtattatgtaaaattgtatttcagcccatattgttt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46264088 |
ttaaatcttcttttacatatcctatatttcaagagatgcctttctcataaagatgttagaattggtattatgtaaaattgtatttcagcccatattgttt |
46263989 |
T |
 |
| Q |
318 |
attcaatcctctaactctagtttctttatcttctttcccaagacctggattctctatctgcatgatataaatttcattg |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46263988 |
attcaatcctctaactctagtttctttatcttctttcccaagacctggattctctatctgcatgatataaatttcattg |
46263910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 44; Significance: 6e-16; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 124 - 215
Target Start/End: Original strand, 27774836 - 27774927
Alignment:
| Q |
124 |
aaattttgtagtgttattgttaaagcagataagaaacttttgactgtacagtttcccgatggtcatgagggacgggctttcacacttaaggt |
215 |
Q |
| |
|
||||||||||||||| | | ||||||||||||||||||||||||||||| |||||| ||| |||||| ||||| | || ||||||||||| |
|
|
| T |
27774836 |
aaattttgtagtgtttctatcaaagcagataagaaacttttgactgtacaatttcccaatgttcatgatggacgagtattaacacttaaggt |
27774927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University