View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10211_low_26 (Length: 355)
Name: NF10211_low_26
Description: NF10211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10211_low_26 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 3 - 336
Target Start/End: Complemental strand, 47254280 - 47253947
Alignment:
| Q |
3 |
cacagatactcctgccaatttcaataaatttcatgtgaggttaatcatctcttgctttttctaagaaataggacatctcaagattttcctgtttaactca |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47254280 |
cacagatactcctgccaatttcaataaatttcatgtgaggttaatcatctcttgctttttctaagaaataggacatctcaagattttcctgtttaactca |
47254181 |
T |
|
| Q |
103 |
actacatgaaacttagtatgtggttagttgtgcgtttaatttccgtcaccaaacgcacgtttatggctcttttactgtaatttaaagaagctccaaaatc |
202 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
47254180 |
actacatgaaacttagtatgtgtttagttgtgcgtttaatttccgtcaccaaacgcacgtttatggctcttttactgcaatttaaagaagctccaaaatc |
47254081 |
T |
|
| Q |
203 |
aagcttccgtggcaatgtggtttctcaccatggaaatgttaaactcaccgttaaagcaaacacatgcttaatcgagggaactgctttgtaaagtgaagat |
302 |
Q |
| |
|
||||||| ||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
47254080 |
aagcttctgtggcaatgtggtttttcaccacggaaatgttaaactcaccgttaaagcaaacacatgcttaatcgagggaactgctttgtaaagtaaagat |
47253981 |
T |
|
| Q |
303 |
gaaaactgcttggtcaccaagtctctcatggtga |
336 |
Q |
| |
|
|||||||| |||||| |||||||||||||||||| |
|
|
| T |
47253980 |
gaaaactgtttggtcgccaagtctctcatggtga |
47253947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University