View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10211_low_42 (Length: 259)

Name: NF10211_low_42
Description: NF10211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10211_low_42
NF10211_low_42
[»] chr8 (1 HSPs)
chr8 (20-248)||(22488047-22488275)


Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 20 - 248
Target Start/End: Complemental strand, 22488275 - 22488047
Alignment:
20 gaaagcatatcataattcttctgcaatgactgtttagttttggtcatgatttgatgacatggttttattatgggagtgattatgtttaaacattgtttta 119  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
22488275 gaaagcatatcataattcttctgcaatgactgtttagttttggtcatgatttgatgacatggttttattatgggagtgattatgtttagacattgtttta 22488176  T
120 ataggtttccatcagattggacctgttaaacggagtagatccagcaatagtgcagattaagggacatttgttgataacaaaatatatcatccttgcctaa 219  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||| ||||||||| ||||    
22488175 ataggtttccatcagattggacctgttaaacggagtagatccaacaatagtgtagattaagggacatttgttgataacaaaatatttcatccttgactaa 22488076  T
220 tgacaatgtgttgtttatgtctgattcat 248  Q
    |||||||||||||||||||||||||||||    
22488075 tgacaatgtgttgtttatgtctgattcat 22488047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University