View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10211_low_42 (Length: 259)
Name: NF10211_low_42
Description: NF10211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10211_low_42 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 20 - 248
Target Start/End: Complemental strand, 22488275 - 22488047
Alignment:
| Q |
20 |
gaaagcatatcataattcttctgcaatgactgtttagttttggtcatgatttgatgacatggttttattatgggagtgattatgtttaaacattgtttta |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
22488275 |
gaaagcatatcataattcttctgcaatgactgtttagttttggtcatgatttgatgacatggttttattatgggagtgattatgtttagacattgtttta |
22488176 |
T |
|
| Q |
120 |
ataggtttccatcagattggacctgttaaacggagtagatccagcaatagtgcagattaagggacatttgttgataacaaaatatatcatccttgcctaa |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
22488175 |
ataggtttccatcagattggacctgttaaacggagtagatccaacaatagtgtagattaagggacatttgttgataacaaaatatttcatccttgactaa |
22488076 |
T |
|
| Q |
220 |
tgacaatgtgttgtttatgtctgattcat |
248 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
22488075 |
tgacaatgtgttgtttatgtctgattcat |
22488047 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University