View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10211_low_43 (Length: 255)
Name: NF10211_low_43
Description: NF10211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10211_low_43 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 210
Target Start/End: Complemental strand, 9221627 - 9221418
Alignment:
| Q |
1 |
aagataagttcattaacaggatcagaatatgggaataagggaaaaagaattgtgcttgctgtgatatctctggttgccttattattcttcttcatgaaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9221627 |
aagataagttcattaacaggatcagaatatgggaataagggaaaaagaattgtgcttgctgtgatatctctggttgccttattattcttcttcatgaaac |
9221528 |
T |
|
| Q |
101 |
tagctttataaaagccttgtcatgaatcatgccatgctccatttgttaactttaggtacannnnnnnatgcaaaaataattttattaatagagaaaaaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
9221527 |
tagctttataaaagccttgtcatgaatcatgccatggtccatttgttaactttaggtacatttttttatgcaaaaataattttattaatagagaaaaaat |
9221428 |
T |
|
| Q |
201 |
aaaaccatag |
210 |
Q |
| |
|
|||||||||| |
|
|
| T |
9221427 |
aaaaccatag |
9221418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 211 - 239
Target Start/End: Complemental strand, 9221345 - 9221317
Alignment:
| Q |
211 |
tcgaattaagattggactacacaaatttt |
239 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
9221345 |
tcgaattaagattggactacacaaatttt |
9221317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University