View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10211_low_48 (Length: 249)
Name: NF10211_low_48
Description: NF10211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10211_low_48 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 22440085 - 22439859
Alignment:
| Q |
1 |
atgaagtggaagtgggaatcgtagtatcataattttggcgggaaaaaatggagtgaggttgttatcggcttcgttttgtgtgggttggtttggttcgagg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
22440085 |
atgaagtggaagtgggaatcgtagtatcataattttggcgggaaaaaaatg---gaggttgttatcggcttcgtttt-tgtgggttggtttggttcgagg |
22439990 |
T |
|
| Q |
101 |
tttttcagttgacaatcaat----gaacgg-aaggttgctggttggttagttggttacgtgttttgatttcccattgcttccaattttgtctttttcgtt |
195 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
22439989 |
tttttcagttgacaatcaatcaatgaacgggaaggttgctggttggttagttggttacgtgttttgattttccattgcttccaattttgtctttttcgtt |
22439890 |
T |
|
| Q |
196 |
tcacaaaacaaagctttgtcttttcaaaggg |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
22439889 |
tcacaaaacaaagctttgtcttttcaaaggg |
22439859 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University