View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10211_low_51 (Length: 246)
Name: NF10211_low_51
Description: NF10211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10211_low_51 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 14 - 228
Target Start/End: Original strand, 25883654 - 25883868
Alignment:
| Q |
14 |
agaccgatgacacggattggccaatgagctctcgcatcccgatgtgttctcgatatgacttttacgaagctaaattttgctgctttgagttagaatcgtt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
25883654 |
agaccgatgacacggattggccaatgagctctcgcatcccgatgtgttgtcaatatgacttttacgaagctaaattttgctgctttgagttagactcgtt |
25883753 |
T |
|
| Q |
114 |
gggtgggacattcagcgtgataccaaacataataaaacttttccatatagcaatttgaacatattttcacttagttttcaacaaactagaaccagaattg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
25883754 |
gggtgggacattcagcgtgataccaaacataataaaacttttccatatagcaatttgaacatattttcacttagttttcaacaaactagaactagaattg |
25883853 |
T |
|
| Q |
214 |
ctactttgctacatc |
228 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
25883854 |
ctactttgctacatc |
25883868 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University