View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10211_low_54 (Length: 242)
Name: NF10211_low_54
Description: NF10211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10211_low_54 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 48176837 - 48176595
Alignment:
| Q |
1 |
ctacaaaagatttacgaaataataagcgcaaccaatgaacttacgatctttgttaacgaaattaatttggctaattgtgccaacgttaccgattatcaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
48176837 |
ctacaaaagatttacgaaataataagcgcaaccaatgaacttacgatctttgttaacgaaattaatttggctaattgtgccaacgttaccgattgtcaag |
48176738 |
T |
 |
| Q |
101 |
gccatgcgcaagggtgggtctcacctccgcttgttcgtccctgcccacttgccggtacctatgaggaatatctaacatactcaacagttctacttcta-- |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48176737 |
gccatgcgcaagggtgggtctcacctccgcttgttcgtccctgcccacttgccggtacctatgaggaatatctaacatactcaacagttctacttctact |
48176638 |
T |
 |
| Q |
199 |
-ccattctataatcagtaatagtggttccaacgatgttctgtg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48176637 |
tccattctataatcagtaatagtggttccaacgatgttctgtg |
48176595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University