View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10211_low_56 (Length: 238)
Name: NF10211_low_56
Description: NF10211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10211_low_56 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 8 - 207
Target Start/End: Complemental strand, 55378113 - 55377913
Alignment:
| Q |
8 |
gatggacatcatatatcacttgaagcaatggtggaatttcttaatctaatgatgaaatcaaacttgtgatcgtaaatgatacaacatctagttcaactgt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55378113 |
gatggacatcatatatcacttgaagcaatggtggaatttcttaatctaatgatgaaatcaaacttgtgatcgtaaatgatacaacatctagttcaactgt |
55378014 |
T |
|
| Q |
108 |
gtacactatactataactagatatt-ttttagtataacaatgttacttgaaatctaaaatccgatagcatataaaaatacatgacatatagctattgatt |
206 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55378013 |
gtacactatactataactagatatttttttagtataacaatgttacttgaaatctaaaatccgatagcatataaaaatacatgacatatagctattgatt |
55377914 |
T |
|
| Q |
207 |
t |
207 |
Q |
| |
|
| |
|
|
| T |
55377913 |
t |
55377913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University