View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10211_low_57 (Length: 236)

Name: NF10211_low_57
Description: NF10211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10211_low_57
NF10211_low_57
[»] chr4 (2 HSPs)
chr4 (17-77)||(40609799-40609859)
chr4 (133-188)||(40609494-40609549)


Alignment Details
Target: chr4 (Bit Score: 57; Significance: 6e-24; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 17 - 77
Target Start/End: Complemental strand, 40609859 - 40609799
Alignment:
17 atatcgaacatataattaatcttttattggtttggaagcatattgaacatcattataatta 77  Q
    ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
40609859 atatcgaacatataattaatcttttattggtttcgaagcatattgaacatcattataatta 40609799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 133 - 188
Target Start/End: Complemental strand, 40609549 - 40609494
Alignment:
133 ggtcggcaatactttatgtttcttatgtaggaaggaatagacaaaataacttgatt 188  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40609549 ggtcggcaatactttatgtttcttatgtaggaaggaatagacaaaataacttgatt 40609494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University