View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10211_low_57 (Length: 236)
Name: NF10211_low_57
Description: NF10211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10211_low_57 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 57; Significance: 6e-24; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 17 - 77
Target Start/End: Complemental strand, 40609859 - 40609799
Alignment:
| Q |
17 |
atatcgaacatataattaatcttttattggtttggaagcatattgaacatcattataatta |
77 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
40609859 |
atatcgaacatataattaatcttttattggtttcgaagcatattgaacatcattataatta |
40609799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 133 - 188
Target Start/End: Complemental strand, 40609549 - 40609494
Alignment:
| Q |
133 |
ggtcggcaatactttatgtttcttatgtaggaaggaatagacaaaataacttgatt |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40609549 |
ggtcggcaatactttatgtttcttatgtaggaaggaatagacaaaataacttgatt |
40609494 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University